Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ABC0466 gene

Properties
Regulog: GudR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucarate utilization; Galactarate utilization
Effector:
Phylum: Firmicutes
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus clausii KSM-K16
Position: -50
Score: 5.94845
Sequence: TCTATTTGTCTTACAATTAAT
Locus tag: ABC0466
Name: ABC0466
Funciton: Putative mannonate dehydratase (EC 4.2.1.8)
ABC0466 -50 5.9 TCTATTTGTCTTACAATTAAT ABC0466