Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing iolS gene

Properties
Regulog: IolR - Bacillales
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Inositol utilization
Effector: 2-deoxy-5-keto-D-gluconate 6-phosphate
Phylum: Firmicutes
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus amyloliquefaciens FZB42
Position: -69
Score: -0.587287
Sequence: ACTATTGATTAACTTCTGGTGT
Locus tag: RBAM_036790
Name: iolR
Funciton: Transcriptional regulator of myo-inositol utilization, DeoR family
Locus tag: RBAM_036800
Name: iolS
Funciton: Oxidoreductase
iolR-iolS -69 -0.6 ACTATTGATTAACTTCTGGTGT RBAM_036790
Bacillus licheniformis DSM 13
Position: -66
Score: -1.71918
Sequence: ATTATTGGTTAACTTTTGGGTT
Locus tag: BLi04252
Name: iolR
Funciton: Transcriptional regulator of myo-inositol utilization, DeoR family
Locus tag: BLi04253
Name: iolS
Funciton: Oxidoreductase
iolR-iolS -66 -1.7 ATTATTGGTTAACTTTTGGGTT BLi04252
Bacillus subtilis subsp. subtilis str. 168
Position: -69
Score: -1.47248
Sequence: ACTATTGATTAACTTTTGGTTT
Locus tag: BSU39770
Name: iolR
Funciton: Transcriptional regulator of myo-inositol utilization, DeoR family
Locus tag: BSU39780
Name: iolS
Funciton: Oxidoreductase
iolR-iolS -69 -1.5 ACTATTGATTAACTTTTGGTTT BSU39770