Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing iolG gene

Regulog: IolR - Bacillales
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Inositol utilization
Effector: 2-deoxy-5-keto-D-gluconate 6-phosphate
Phylum: Firmicutes
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus amyloliquefaciens FZB42
Position: -224
Score: 6.54509
Position: -213
Score: 4.5549
Locus tag: RBAM_036780
Name: iolA
Funciton: Methylmalonate-semialdehyde dehydrogenase (EC
Locus tag: RBAM_036770
Name: iolB
Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
Locus tag: RBAM_036760
Name: iolC
Funciton: 5-keto-2-deoxygluconokinase (EC
Locus tag: RBAM_036750
Name: iolD
Funciton: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
Locus tag: RBAM_036740
Name: iolE
Funciton: Inosose dehydratase (EC
Locus tag: RBAM_036730
Name: iolF
Funciton: Minor myo-inositol transporter IolF
Locus tag: RBAM_036720
Name: iolG
Funciton: Myo-inositol 2-dehydrogenase 1 (EC
Locus tag: RBAM_036710
Name: iolH
Funciton: putative sugar-phosphate epimerase/isomerase IolH
Locus tag: RBAM_036700
Name: iolI
Funciton: Inosose isomerase (EC 5.3.99.-)
Locus tag: RBAM_036690
Name: iolJ
Funciton: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC
iolA-iolB-iolC-iolD-iolE-iolF-iolG-iolH-iolI-iolJ -224 6.5 TAACCAAGAAATGACCAAAACA RBAM_036780
Bacillus clausii KSM-K16
Position: -66
Score: 5.91122
Locus tag: ABC0422
Name: iolA
Funciton: Methylmalonate-semialdehyde dehydrogenase (EC
Locus tag: ABC0423
Name: iolB
Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
Locus tag: ABC0424
Name: iolC
Funciton: 5-keto-2-deoxygluconokinase (EC
Locus tag: ABC0425
Name: iolD
Funciton: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
Locus tag: ABC0426
Name: iolE
Funciton: Inosose dehydratase (EC
Locus tag: ABC0427
Name: iolG
Funciton: Myo-inositol 2-dehydrogenase 1 (EC
Locus tag: ABC0428
Name: iolJ
Funciton: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC
Locus tag: ABC0429
Name: iolX
Funciton: Scyllo-inositol dehydrogenase (EC 1.1.1.-)
Locus tag: ABC0430
Name: null
Funciton: Na+:myo-inositol cotransporter
iolA-iolB-iolC-iolD-iolE-iolG-iolJ-iolX-ABC0430 -66 5.9 TAACCAACAAATGATCAAAAAG ABC0422
Bacillus licheniformis DSM 13
Position: -242
Score: 6.44205
Locus tag: BLi04251
Name: iolA
Funciton: Methylmalonate-semialdehyde dehydrogenase (EC
Locus tag: BLi04250
Name: iolB
Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
Locus tag: BLi04249
Name: iolC
Funciton: 5-keto-2-deoxygluconokinase (EC
Locus tag: BLi04248
Name: iolD
Funciton: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
Locus tag: BLi04247
Name: iolE
Funciton: Inosose dehydratase (EC
Locus tag: BLi04246
Name: iolF
Funciton: Minor myo-inositol transporter IolF
Locus tag: BLi04245
Name: iolG
Funciton: Myo-inositol 2-dehydrogenase 1 (EC
Locus tag: BLi04244
Name: iolH
Funciton: putative sugar-phosphate epimerase/isomerase IolH
Locus tag: BLi04243
Name: iolI
Funciton: Inosose isomerase (EC 5.3.99.-)
Locus tag: BLi04242
Name: iolJ
Funciton: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC
iolA-iolB-iolC-iolD-iolE-iolF-iolG-iolH-iolI-iolJ -242 6.4 TAACCAAGAAGTGACCAAAACA BLi04251
Bacillus subtilis subsp. subtilis str. 168
Position: -196
Score: 6.44205
Locus tag: BSU39760
Name: iolA
Funciton: Methylmalonate-semialdehyde dehydrogenase (EC
Locus tag: BSU39750
Name: iolB
Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
Locus tag: BSU39740
Name: iolC
Funciton: 5-keto-2-deoxygluconokinase (EC
Locus tag: BSU39730
Name: iolD
Funciton: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
Locus tag: BSU39720
Name: iolE
Funciton: Inosose dehydratase (EC
Locus tag: BSU39710
Name: iolF
Funciton: Minor myo-inositol transporter IolF
Locus tag: BSU39700
Name: iolG
Funciton: Myo-inositol 2-dehydrogenase 1 (EC
Locus tag: BSU39690
Name: iolH
Funciton: putative sugar-phosphate epimerase/isomerase IolH
Locus tag: BSU39680
Name: iolI
Funciton: Inosose isomerase (EC 5.3.99.-)
Locus tag: BSU39670
Name: iolJ
Funciton: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC
iolA-iolB-iolC-iolD-iolE-iolF-iolG-iolH-iolI-iolJ -196 6.4 TAACCAAGAAATGACCAAAAAG BSU39760