Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing iolX gene

Properties
Regulog: IolR - Bacillales
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Inositol utilization
Effector: 2-deoxy-5-keto-D-gluconate 6-phosphate
Phylum: Firmicutes
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus clausii KSM-K16
Position: -66
Score: 5.91122
Sequence: TAACCAACAAATGATCAAAAAG
Locus tag: ABC0422
Name: iolA
Funciton: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
Locus tag: ABC0423
Name: iolB
Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
Locus tag: ABC0424
Name: iolC
Funciton: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
Locus tag: ABC0425
Name: iolD
Funciton: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
Locus tag: ABC0426
Name: iolE
Funciton: Inosose dehydratase (EC 4.2.1.44)
Locus tag: ABC0427
Name: iolG
Funciton: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
Locus tag: ABC0428
Name: iolJ
Funciton: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
Locus tag: ABC0429
Name: iolX
Funciton: Scyllo-inositol dehydrogenase (EC 1.1.1.-)
Locus tag: ABC0430
Name: null
Funciton: Na+:myo-inositol cotransporter
iolA-iolB-iolC-iolD-iolE-iolG-iolJ-iolX-ABC0430 -66 5.9 TAACCAACAAATGATCAAAAAG ABC0422