Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing marB gene

Regulog: MarR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: MarR
Regulation mode: repressor
Biological process: Antibiotic resistance
Effector: Salicylate; Tetracycline; Chloramphenicol
Phylum: Proteobacteria/gamma
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -57
Score: 6.66333
Position: -22
Score: 6.73484
Locus tag: CKO_01551
Name: marR
Funciton: DNA-binding transcriptional repressor MarR
Locus tag: CKO_01552
Name: marA
Funciton: DNA-binding transcriptional activator MarA
Locus tag: CKO_01553
Name: marB
Funciton: multiple antibiotic resistance protein
Enterobacter sp. 638
Position: -58
Score: 6.75166
Position: -22
Score: 6.73484
Locus tag: Ent638_1998
Name: marR
Funciton: DNA-binding transcriptional repressor MarR
Locus tag: Ent638_1997
Name: marA
Funciton: DNA-binding transcriptional activator MarA
Locus tag: Ent638_1996
Name: marB
Funciton: multiple antibiotic resistance protein
marR-marA-marB -58 6.8 TATACTTGCCTGAGCAATAATA Ent638_1998
Escherichia coli str. K-12 substr. MG1655
Position: -57
Score: 6.81749
Position: -22
Score: 6.27991
Locus tag: b1530
Name: marR
Funciton: DNA-binding transcriptional repressor MarR
Locus tag: b1531
Name: marA
Funciton: DNA-binding transcriptional activator MarA
Locus tag: b1532
Name: marB
Funciton: multiple antibiotic resistance protein
marR-marA-marB -57 6.8 TATACTTGCCTGGGCAATATTA b1530
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -57
Score: 6.34166
Position: -22
Score: 6.95983
Locus tag: KPN_01625
Name: marR
Funciton: DNA-binding transcriptional repressor MarR
Locus tag: KPN_01624
Name: marA
Funciton: DNA-binding transcriptional activator MarA
Locus tag: KPN_01623
Name: marB
Funciton: multiple antibiotic resistance protein
Salmonella typhimurium LT2
Position: -57
Score: 6.9657
Position: -22
Score: 6.79352
Locus tag: STM1520
Name: marR
Funciton: DNA-binding transcriptional repressor MarR
Locus tag: STM1519.S
Name: marA
Funciton: DNA-binding transcriptional activator MarA
Locus tag: STM1518
Name: marB
Funciton: multiple antibiotic resistance protein