Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing lacA gene

Properties
Regulog: LacI - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Lactose utilization
Effector: Allolactose
Phylum: Proteobacteria/gamma
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -38
Score: 7.41669
Sequence: AATTGTGAGCGGATAACAATT
Locus tag: b0344
Name: lacZ
Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: b0343
Name: lacY
Funciton: Lactose permease, MFS family
Locus tag: b0342
Name: lacA
Funciton: Galactoside O-acetyltransferase (EC 2.3.1.18)
lacZ-lacY-lacA -38 7.4 AATTGTGAGCGGATAACAATT b0344