Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing lacZ gene

Properties
Regulog: LacI - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Lactose utilization
Effector: Allolactose
Phylum: Proteobacteria/gamma
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -38
Score: 6.99698
Sequence: AATTGTGAGCGAATAACAAAC
Locus tag: CKO_02825
Name: lacZ
Funciton: Beta-galactosidase (EC 3.2.1.23)
lacZ -38 7 AATTGTGAGCGAATAACAAAC CKO_02825
Enterobacter sp. 638
Position: -29
Score: 6.31904
Sequence: AATTGTGAGCGCTTCGCAAAG
Locus tag: Ent638_0928
Name: lacZ
Funciton: Beta-galactosidase (EC 3.2.1.23)
lacZ -29 6.3 AATTGTGAGCGCTTCGCAAAG Ent638_0928
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -73
Score: 7.41669
Sequence: AATTGTGAGCGGATAACAATT
Locus tag: ECA1490
Name: lacZ
Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: ECA1489
Name: lacY
Funciton: Lactose permease, MFS family
lacZ-lacY -73 7.4 AATTGTGAGCGGATAACAATT ECA1490
Escherichia coli str. K-12 substr. MG1655
Position: -38
Score: 7.41669
Sequence: AATTGTGAGCGGATAACAATT
Locus tag: b0344
Name: lacZ
Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: b0343
Name: lacY
Funciton: Lactose permease, MFS family
Locus tag: b0342
Name: lacA
Funciton: Galactoside O-acetyltransferase (EC 2.3.1.18)
lacZ-lacY-lacA -38 7.4 AATTGTGAGCGGATAACAATT b0344
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -37
Score: 7.19071
Sequence: AAATGTGAGCGGATAACAATT
Locus tag: KPN_pKPN3p05871
Name: lacZ
Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: KPN_pKPN3p05870
Name: lacY
Funciton: Lactose permease, MFS family
lacZ-lacY -37 7.2 AAATGTGAGCGGATAACAATT KPN_pKPN3p05871