Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.3 --

Orthologous regulated operons containing glcD gene

Properties
Regulog: PdhR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Pyruvate metabolism
Effector: Pyruvate
Phylum: Proteobacteria/gamma
Built upon 44 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -238
Score: 4.01435
Sequence: TGCACAGGTAGGACCAATTTT
Position: -121
Score: 3.94205
Sequence: AAAAATGGTCTGACCGGTAGC
Locus tag: b2979
Name: glcD
Funciton: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
Locus tag: b4468
Name: glcE
Funciton: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
Locus tag: b4467
Name: glcF
Funciton: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
Locus tag: b2977
Name: glcG
Funciton: Hypothetical protein GlcG in glycolate utilization operon
Locus tag: b2976
Name: glcB
Funciton: Malate synthase G (EC 2.3.3.9)
glcD-glcE-glcF-glcG-glcB -238 4 TGCACAGGTAGGACCAATTTT b2979
-121 3.9 AAAAATGGTCTGACCGGTAGC