Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing bglP gene

Regulog: AscG - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization; Cellobiose utilization
Effector: Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum: Proteobacteria/gamma
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Enterobacter sp. 638
Position: -72
Score: 4.73279
Locus tag: Ent638_0038
Name: celA
Funciton: PTS system, cellobiose-specific IIB component (EC
Locus tag: Ent638_0037
Name: celB
Funciton: PTS system, cellobiose-specific IIC component (EC
Locus tag: Ent638_0036
Name: bglB
Funciton: Beta-glucosidase (EC
Locus tag: Ent638_0035
Name: celC
Funciton: PTS system, cellobiose-specific IIA component (EC
Locus tag: Ent638_0034
Name: bglP
Funciton: putative outer membrane porin for beta-glucoside utilization
celA-celB-bglB-celC-bglP -72 4.7 AATGGAAACCGGTTTCCATA Ent638_0038
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -198
Score: 4.34116
Position: -72
Score: 4.61925
Locus tag: KPN_04054
Name: celA
Funciton: PTS system, cellobiose-specific IIB component (EC
Locus tag: KPN_04055
Name: celB
Funciton: PTS system, cellobiose-specific IIC component (EC
Locus tag: KPN_04056
Name: celC
Funciton: PTS system, cellobiose-specific IIA component (EC
Locus tag: KPN_04057
Name: bglP
Funciton: putative outer membrane porin for beta-glucoside utilization
celA-celB-celC-bglP -198 4.3 TTTGGAAACCGATTTTCCAT KPN_04054