Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing celC2 gene

Properties
Regulog: AscG - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization; Cellobiose utilization
Effector: Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum: Proteobacteria/gamma
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -117
Score: 5.61192
Sequence: TACTGCAACCGGTTTCAGTT
Locus tag: CKO_02999
Name: celA2
Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: CKO_03000
Name: celC2
Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
celA2-celC2 -117 5.6 TACTGCAACCGGTTTCAGTT CKO_02999
Enterobacter sp. 638
Position: -126
Score: 5.42311
Sequence: AATTGAAACCGGTTTCATAG
Locus tag: Ent638_0200
Name: celA2
Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: Ent638_0199
Name: celC2
Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
celA2-celC2 -126 5.4 AATTGAAACCGGTTTCATAG Ent638_0200
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -151
Score: 5.75845
Sequence: AAATGAAACCGGTTTCAATT
Locus tag: KPN_04369
Name: celA2
Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: KPN_04368
Name: celC2
Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
celA2-celC2 -151 5.8 AAATGAAACCGGTTTCAATT KPN_04369