Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ascF gene

Properties
Regulog: AscG - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization; Cellobiose utilization
Effector: Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum: Proteobacteria/gamma
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -103
Score: 5.09137
Sequence: TTGTGGAACCGGTTTCCTAT
Locus tag: CKO_04070
Name: ascF
Funciton: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
Locus tag: CKO_04071
Name: ascB
Funciton: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
ascF-ascB -103 5.1 TTGTGGAACCGGTTTCCTAT CKO_04070
Enterobacter sp. 638
Position: -52
Score: 5.61162
Sequence: TTGTGAAACCGGTTTCCTAT
Locus tag: Ent638_3188
Name: ascF
Funciton: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
Locus tag: Ent638_3189
Name: ascB
Funciton: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
ascF-ascB -52 5.6 TTGTGAAACCGGTTTCCTAT Ent638_3188
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -180
Score: 5.11246
Sequence: ATGTGGAACCGGTTACCCAT
Locus tag: ECA2165
Name: ascF
Funciton: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
Locus tag: ECA2166
Name: ascB
Funciton: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
ascF-ascB -180 5.1 ATGTGGAACCGGTTACCCAT ECA2165
Escherichia coli str. K-12 substr. MG1655
Position: -177
Score: 5.14489
Sequence: TCAGGTGACCGGTTTCACAA
Position: -101
Score: 5.84427
Sequence: TTGTGAAACCGGTTTCTTAA
Locus tag: b2715
Name: ascF
Funciton: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
Locus tag: b2716
Name: ascB
Funciton: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
ascF-ascB -177 5.1 TCAGGTGACCGGTTTCACAA b2715
-101 5.8 TTGTGAAACCGGTTTCTTAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -93
Score: 5.09137
Sequence: TTGTGGAACCGGTTTCCTAT
Locus tag: KPN_03051
Name: ascF
Funciton: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
Locus tag: KPN_03052
Name: ascB
Funciton: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
ascF-ascB -93 5.1 TTGTGGAACCGGTTTCCTAT KPN_03051
Serratia proteamaculans 568
Position: -113
Score: 5.81364
Sequence: TTGTGAAACCGGTTTCTTAT
Locus tag: Spro_0576
Name: ascF
Funciton: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
Locus tag: Spro_0575
Name: ascB
Funciton: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
ascF-ascB -113 5.8 TTGTGAAACCGGTTTCTTAT Spro_0576