Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ascG gene

Properties
Regulog: AscG - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization; Cellobiose utilization
Effector: Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum: Proteobacteria/gamma
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -172
Score: 6.67314
Sequence: ATAGGAAACCGGTTCCACAA
Locus tag: CKO_04069
Name: ascG
Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
ascG -172 6.7 ATAGGAAACCGGTTCCACAA CKO_04069
Enterobacter sp. 638
Position: -182
Score: 6.71924
Sequence: ATAGGAAACCGGTTTCACAA
Locus tag: Ent638_3187
Name: ascG
Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
ascG -182 6.7 ATAGGAAACCGGTTTCACAA Ent638_3187
Erwinia amylovora ATCC 49946
Position: -297
Score: 6.10165
Sequence: TTCTGCAACCGGTTTCATAT
Locus tag: EAM_2929
Name: ascG
Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
ascG -297 6.1 TTCTGCAACCGGTTTCATAT EAM_2929
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -173
Score: 6.02897
Sequence: ATGGGTAACCGGTTCCACAT
Locus tag: ECA2164
Name: ascG
Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
ascG -173 6 ATGGGTAACCGGTTCCACAT ECA2164
Escherichia coli str. K-12 substr. MG1655
Position: -175
Score: 6.34104
Sequence: TTAAGAAACCGGTTTCACAA
Locus tag: b2714
Name: ascG
Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
ascG -175 6.3 TTAAGAAACCGGTTTCACAA b2714
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -194
Score: 6.67314
Sequence: ATAGGAAACCGGTTCCACAA
Locus tag: KPN_03050
Name: ascG
Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
ascG -194 6.7 ATAGGAAACCGGTTCCACAA KPN_03050
Serratia proteamaculans 568
Position: -193
Score: 6.48083
Sequence: ATAAGAAACCGGTTTCACAA
Locus tag: Spro_0577
Name: ascG
Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
ascG -193 6.5 ATAAGAAACCGGTTTCACAA Spro_0577