Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing bglG gene

Regulog: AscG - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization; Cellobiose utilization
Effector: Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum: Proteobacteria/gamma
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Erwinia amylovora ATCC 49946
Position: -68
Score: 6.59023
Locus tag: EAM_2930
Name: bglE
Funciton: PTS system, beta-glucoside-specific IIB component (EC
Locus tag: EAM_2931
Name: bglF
Funciton: PTS system, beta-glucoside-specific IIC component (EC
Locus tag: EAM_2932
Name: bglG
Funciton: PTS system, beta-glucoside-specific IIA component (EC
Locus tag: EAM_2933
Name: bglA
Funciton: 6-phospho-beta-glucosidase (EC
Locus tag: EAM_2934
Name: bglA
Funciton: 6-phospho-beta-glucosidase (EC
bglE-bglF-bglG-bglA-bglA -68 6.6 ATATGAAACCGGTTGCAGAA EAM_2930
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -69
Score: 6.55959
Locus tag: ECA4435
Name: bglE
Funciton: PTS system, beta-glucoside-specific IIB component (EC
Locus tag: ECA4434
Name: bglF
Funciton: PTS system, beta-glucoside-specific IIC component (EC
Locus tag: ECA4433
Name: bglG
Funciton: PTS system, beta-glucoside-specific IIA component (EC
Locus tag: ECA4432
Name: bglA
Funciton: 6-phospho-beta-glucosidase (EC
bglE-bglF-bglG-bglA -69 6.6 ATATGAAACCGGTTGCATAT ECA4435
Serratia proteamaculans 568
Position: -99
Score: 4.87755
Position: -86
Score: 5.4333
Locus tag: Spro_4224
Name: bglE
Funciton: PTS system, beta-glucoside-specific IIB component (EC
Locus tag: Spro_4223
Name: bglF
Funciton: PTS system, beta-glucoside-specific IIC component (EC
Locus tag: Spro_4222
Name: bglG
Funciton: PTS system, beta-glucoside-specific IIA component (EC
bglE-bglF-bglG -99 4.9 CCCTGCAACCGGTTACTGAA Spro_4224